View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3104_low_15 (Length: 319)
Name: NF3104_low_15
Description: NF3104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3104_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 297
Target Start/End: Original strand, 8188122 - 8188402
Alignment:
| Q |
17 |
ggtactagtgatggttttaggatagaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagatactgaggatgctatttgtatgcgta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188122 |
ggtactagtgatggttttaggatagaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagatactgaggatgctatttgtatgcgta |
8188221 |
T |
|
| Q |
117 |
ctagagctcgttattcgcttgaaggtttcagtcttgatgagcttgagacctttcttcaagagaccgatgatgaagatgatgttcaaaatgtcgatgatga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188222 |
ctagagctcgttattcgcttgaaggtttcagtcttgatgagcttgagacctttcttcaagagactgatgatgaagatgatgttcaaaatgtcgatgatga |
8188321 |
T |
|
| Q |
217 |
agaagagtataaaaaatttctagcagctgtattacagggtggagaacgtgacggtctttcatctcatgaaaatgaaaacct |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188322 |
agaagagtataaaaaatttctagcagctgtattacagggtggagaacgtgacggtctttcatctcatgaaaatgaaaacct |
8188402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University