View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3104_low_21 (Length: 263)
Name: NF3104_low_21
Description: NF3104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3104_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 71 - 259
Target Start/End: Complemental strand, 52672373 - 52672186
Alignment:
| Q |
71 |
atttaattgatgcaaggctttatcttggaaaaaacaaacacttcttattgttcccctcctcgaaatagggtttcatttgtgttctttgttcactttctca |
170 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52672373 |
atttaattgatgcaagtctttatcttggaaaaaacaaacacttcttattgttcccctcctcgaaatagggtttcatttgtgttctttcttcactttctca |
52672274 |
T |
|
| Q |
171 |
ttccttatttgttgctgtttcatacacacacaaacacttacacattgagaaatgcagccttcttatttctctgtcaattcatctcactc |
259 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
52672273 |
tttcttatttgttgctgtttcatacacacacaaacacttacacattgagaaatgcagccttctt-tttctctgtcaattgatctcactc |
52672186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 52672429 - 52672392
Alignment:
| Q |
17 |
atatattatgtatccaggttcattgattcttaatctct |
54 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52672429 |
atatattgtgtatccaggttcattgattcttaatctct |
52672392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University