View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3104_low_24 (Length: 242)
Name: NF3104_low_24
Description: NF3104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3104_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 4 - 226
Target Start/End: Original strand, 8796389 - 8796609
Alignment:
| Q |
4 |
gatgcatatgtaaacaacaacaaatatcaagcaatcaagattatgatttaaaatctgaatagtattttctgnnnnnnnnnnnnnnnnnnnnngttattat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8796389 |
gatgcatatgtaaacaacaacaaatatcaagcaatcaagattatgatttaaaatctgaatagtattttctggagagagagagagagagag--gttattat |
8796486 |
T |
 |
| Q |
104 |
caccaatattatctgaagatgaagaaactgtaagatttttgaactggacttcaatcctttgaagaaaaagcatagcttcctttaagggtttggaaagttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8796487 |
caccaatattatctgaagatgaagaaactgtaagatttttgaactggacttcaatcctttgaagaaaaagcatagcttcctttaagggtttggaaagttc |
8796586 |
T |
 |
| Q |
204 |
ttgctcatacttgataagcatct |
226 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8796587 |
ttgctcatacttgataagcatct |
8796609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 37099608 - 37099665
Alignment:
| Q |
169 |
aaaagcatagcttcctttaagggtttggaaagttcttgctcatacttgataagcatct |
226 |
Q |
| |
|
|||||||| ||||| || |||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
37099608 |
aaaagcatggcttctttgaagggtttagtgagttcttgctcatacttgataagcatct |
37099665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University