View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3104_low_4 (Length: 494)
Name: NF3104_low_4
Description: NF3104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3104_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 433; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 433; E-Value: 0
Query Start/End: Original strand, 1 - 481
Target Start/End: Original strand, 16910283 - 16910763
Alignment:
| Q |
1 |
attctgttttgctcaatatgatgaagtttatggacacaaaacaagttgttcaaacttgtgtattgtctactagatggaagacactttggcgaagagtcac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910283 |
attctgttttgctcaatataatgaagtttatggacacaaaacaagttgttcaaacttgtgtattgtctactagatggaagacactttggcgaagagtcac |
16910382 |
T |
|
| Q |
101 |
gactcttgcattgaataattcagtattcgctcgtggcttaccgaattataatcaatttgtgttttcagttctgtctcatcgtgacaaatcaatttcttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910383 |
tactcttgcattgaataattcagtattcgctcgtggcttacccaattataatcaatttgtgttttcagttctgtctcatcgtgacaaatcaatttcttta |
16910482 |
T |
|
| Q |
201 |
caagatattgttttaagaaatgaaggaggcgttgaacctgaacttgtggacatggtcatgaaatatgcgatgtcacataatgtcgagaatttcactcttg |
300 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16910483 |
caagatattgttttaagaaatgaaagaggcgttgaacctaaacttgtggacgcggtcatgaaatatgctatgtcacataatgtcgagaatttcacacttg |
16910582 |
T |
|
| Q |
301 |
aactttatttgaatttcaaacccggttacattttgcgccctagcatcttttcttgcaaatctttgacacatctaaagcttttattttggggtgtccgttg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16910583 |
aactttatttgaatttcaaacccggttacactttgcgccctagcatcttttcttgcaaatctttgacacatctaaagcttttattttggggtgtcccttg |
16910682 |
T |
|
| Q |
401 |
gatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgtcacttttgttgcaaatga |
481 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16910683 |
gatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgccacttttgttgcaaatga |
16910763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 288 - 381
Target Start/End: Complemental strand, 50790383 - 50790290
Alignment:
| Q |
288 |
aatttcactcttgaactttatttgaatttcaaacccggttacattttgcgccctagcatcttttcttgcaaatctttgacacatctaaagcttt |
381 |
Q |
| |
|
||||| ||||||||| || ||| |||||| || | |||||||| |||| |||||||||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
50790383 |
aatttaactcttgaagttgattcgaattttaagcgcggttacacattgcaccctagcatcttttcttgtcaatctttgacatgtcttaagcttt |
50790290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University