View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3106_high_20 (Length: 243)
Name: NF3106_high_20
Description: NF3106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3106_high_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 10612290 - 10612517
Alignment:
| Q |
16 |
atttactttcatgctgaaatgaaacaatcactggataaattaagaaatttaaattatgcagccgttttctccattgatgcagttgttgaaatatttattc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10612290 |
atttactttcatgctgaaatgaaacaatcactggataaattaagaaattttaattatgcagccgttttctccatcgatgcagttgttgaaatatttattc |
10612389 |
T |
|
| Q |
116 |
attattggcatcaatactatttgattttatgcttattgtgttttattttaattccttatttcacttattaatttgtggttagtgatggctgcggtggtgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10612390 |
attattggcatcaatactatttgattttatgcttattgtgttttattttaattccttatttcacttattaatttgtggttagtgatggctgcggtggtgt |
10612489 |
T |
|
| Q |
216 |
ttacggcagcattggagccttcatctca |
243 |
Q |
| |
|
|||||| |||||||||||||||| |||| |
|
|
| T |
10612490 |
ttacggtagcattggagccttcaactca |
10612517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 130 - 188
Target Start/End: Original strand, 41240654 - 41240712
Alignment:
| Q |
130 |
tactatttgattttatgcttattgtgttttattttaattccttatttcacttattaatt |
188 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
41240654 |
tactatttgattttatgtttattgtattttattttaattccttaaatcacttcttaatt |
41240712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 172
Target Start/End: Original strand, 30984643 - 30984715
Alignment:
| Q |
99 |
tgttgaaatatttattcattattggcatcaatactatttgattttatgcttattgtgttttattttaattcctt |
172 |
Q |
| |
|
|||||||||||||| |||||||| || || |||||| ||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
30984643 |
tgttgaaatatttaatcattattagc-tcgatactacttgattttatgtttatcatgttttattttaattcctt |
30984715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University