View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3106_high_24 (Length: 217)
Name: NF3106_high_24
Description: NF3106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3106_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 36 - 206
Target Start/End: Complemental strand, 27230204 - 27230034
Alignment:
| Q |
36 |
gatccctagtggggatccagttacatcaatagaaagtaagccagcttctttattgtcttgcttttattatcacaaacaaggtattacttattattcatca |
135 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27230204 |
gatctctagtggggatccagttacatcaatagaaagtaagccagcttctttattgtcttgcttttattatcacaaacaaggtattacttattattcatca |
27230105 |
T |
|
| Q |
136 |
agtgcaatcccttcaagttgatcagtactttaccctgcaatgagtaaagtaaatttgatattagttttctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27230104 |
agtgcaatcccttcaagttgatcagtactttaccctgcaatgagtaaagtaaatttgacattagttttctt |
27230034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 3 - 206
Target Start/End: Complemental strand, 27236785 - 27236585
Alignment:
| Q |
3 |
taattattattgaaatgcatagcatagtgatccgatccctagtggggatccagttacatcaatagaaagtaagccagcttctttattgtcttgcttttat |
102 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27236785 |
taattattattgaaatgcatagtatatagt---gatccctagtggggatccagttacatccatagaaagtaagccagcttctttattgtcttgcttttat |
27236689 |
T |
|
| Q |
103 |
tatcacaaacaaggtattacttattattcatcaagtgcaatcccttcaagttgatcagtactttaccctgcaatgagtaaagtaaatttgatattagttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27236688 |
tatcacaaacaaggtattacttattattcatcaattgcaatcccttcaagttgatcagtactttaccctgcaatgagtaaagtaaatttgacattagttt |
27236589 |
T |
|
| Q |
203 |
tctt |
206 |
Q |
| |
|
|||| |
|
|
| T |
27236588 |
tctt |
27236585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 27158696 - 27158654
Alignment:
| Q |
164 |
tttaccctgcaatgagtaaagtaaatttgatattagttttctt |
206 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
27158696 |
tttaccctgcaatgagcaaagtaaatatgacattagttttctt |
27158654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 27230268 - 27230234
Alignment:
| Q |
1 |
tataattattattgaaatgcatagcatagtgatcc |
35 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
27230268 |
tataattattattgaaatgcatagtatagtgatcc |
27230234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 206
Target Start/End: Complemental strand, 27243646 - 27243604
Alignment:
| Q |
164 |
tttaccctgcaatgagtaaagtaaatttgatattagttttctt |
206 |
Q |
| |
|
||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
27243646 |
tttaccctgcaattagtaaagtgaaattgatattagttttctt |
27243604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University