View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3106_low_22 (Length: 245)
Name: NF3106_low_22
Description: NF3106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3106_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 99 - 228
Target Start/End: Original strand, 31903882 - 31904010
Alignment:
| Q |
99 |
cgaaatatgtctctaaatttgtcactgagtgttagcaacctctagttttacgactaattttatctctttgtctttaattttcatcattatttcaattttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
31903882 |
cgaaatatgtctctaaatttgtcactgagtgttagcgacctctagttttacgactaattttatct-tttgtctctaattttcatcattatttcaattttt |
31903980 |
T |
|
| Q |
199 |
ctggtagtgaatcaaataaaaggtataaga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31903981 |
ctggtagtgaatcaaataaaaggtataaga |
31904010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 31903809 - 31903891
Alignment:
| Q |
1 |
ttttgagcacaaaagtta--agttacaacattagaagcaactaactctaccaataatcactactagaaaaacacgaaatatgt |
81 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31903809 |
ttttgagcacaaaagttataagttacaacattagaagcaactaactctaccaataatcactactagaaaaacacgaaatatgt |
31903891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University