View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3106_low_27 (Length: 236)
Name: NF3106_low_27
Description: NF3106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3106_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31439860 - 31440080
Alignment:
| Q |
1 |
cgatgtatgagaatgagtttggatgggggcggccagtggtggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439860 |
cgatgtatgagaatgattttggatgggggcggccgttggcggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaa |
31439959 |
T |
 |
| Q |
101 |
aggtggtggtgcgatggatgtggaggtgcttttggcgccggagacgatggcaaggcttgagagtgatgaggagttcatggtttatgcttcttgtcagcag |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31439960 |
aggtggtggtgcggtggatgtggaggtgcttttggcgccggagacgatggcaaggcttgagagtgatgaggagttcatggcctatgcttcttgtcagcag |
31440059 |
T |
 |
| Q |
201 |
tgacacgtgggagaatgttgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31440060 |
tgacacgtgggagaatgttgg |
31440080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University