View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3106_low_27 (Length: 236)

Name: NF3106_low_27
Description: NF3106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3106_low_27
NF3106_low_27
[»] chr3 (1 HSPs)
chr3 (1-221)||(31439860-31440080)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31439860 - 31440080
Alignment:
1 cgatgtatgagaatgagtttggatgggggcggccagtggtggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaa 100  Q
    |||||||||||||||| |||||||||||||||||  ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31439860 cgatgtatgagaatgattttggatgggggcggccgttggcggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaa 31439959  T
101 aggtggtggtgcgatggatgtggaggtgcttttggcgccggagacgatggcaaggcttgagagtgatgaggagttcatggtttatgcttcttgtcagcag 200  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
31439960 aggtggtggtgcggtggatgtggaggtgcttttggcgccggagacgatggcaaggcttgagagtgatgaggagttcatggcctatgcttcttgtcagcag 31440059  T
201 tgacacgtgggagaatgttgg 221  Q
    |||||||||||||||||||||    
31440060 tgacacgtgggagaatgttgg 31440080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University