View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3106_low_7 (Length: 405)
Name: NF3106_low_7
Description: NF3106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3106_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 6e-81; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 98 - 270
Target Start/End: Complemental strand, 53821 - 53649
Alignment:
| Q |
98 |
ataggtattttgagaagtttgtatgtgagtgagcaatttttgatgggagaagggcaatattcgatttgcaaaccagatttagggcatacataacccgtct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53821 |
ataggtattttgagaagtttgtatgtgagtgagcaatttttgatgggagaagagcaatattcgatttgcaaaccagatttagcgcatacataacccgtct |
53722 |
T |
|
| Q |
198 |
gatggtcatattatgatataaacatgataggacatgaagttagataaagacaatatgtaataaacatgatatc |
270 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53721 |
gatggtcatattatgatatacacatgataggatatgaagttagataaaggcaatatgtaataaacatgatatc |
53649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 53943 - 53869
Alignment:
| Q |
17 |
agcttccaaatgtcttatgcaagttatcgcaagaaatagtgaacttatagacttgcacgaatattgctcttctcc |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53943 |
agcttccaaatgtcttatgcaagttatcgcaagaaatagtgaacttatagacttgcacgaatattgctcttctcc |
53869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 53827 - 53886
Alignment:
| Q |
101 |
ggtattttgagaagtttgtatgtgagtgagcaatttttgatgggagaagggcaatattcg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
53827 |
ggtattttgagaagtttgtatgtgagtgaacaattttttatgggagaagagcaatattcg |
53886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 327 - 376
Target Start/End: Complemental strand, 53592 - 53543
Alignment:
| Q |
327 |
gacatgtaatttttagagactatttgccctcatttatcgcaagggaacac |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53592 |
gacatgtaatttttagagactatttgccctcatttatcgcaaggaaacac |
53543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 113 - 149
Target Start/End: Original strand, 5155501 - 5155537
Alignment:
| Q |
113 |
agtttgtatgtgagtgagcaatttttgatgggagaag |
149 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5155501 |
agtttgtatgtgagggagcaatttttgatgggagaag |
5155537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 113 - 155
Target Start/End: Original strand, 31893914 - 31893956
Alignment:
| Q |
113 |
agtttgtatgtgagtgagcaatttttgatgggagaagggcaat |
155 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
31893914 |
agtttgtatgagagtgagcaattttggatgggagaagagcaat |
31893956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University