View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_35 (Length: 334)
Name: NF3107_high_35
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 265
Target Start/End: Original strand, 26478221 - 26478480
Alignment:
| Q |
9 |
ttgtgctgctggtattaacatttggtgattgatgaaggctgannnnnnnnn---gaaagaaattgatgaagggtgattggttggtggacattcaagttgt |
105 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26478221 |
ttgtgctactagtattaacatttggtgattgatgaaggctgattttttttttttgaaagaaattgatgaagggtgattggttggtggacattcaagttgt |
26478320 |
T |
 |
| Q |
106 |
ctcagttttgggattcaattttataaatgatcatgatcataatggcaaggcagagtgcaatgatattaggtaaattaaggtcatgatgattgatgaccac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26478321 |
ctcagttttgggattcaattttataaatgatcatgatcataatggcaaggtagagtgcaatgatattaggtaaattaagttcatgatgattgatgaccac |
26478420 |
T |
 |
| Q |
206 |
catccttctgcagttccaaagttgctacacccacatcatatattgtcgacatgaggtttt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26478421 |
catccttctgcagttccaaagttgctacacccacatcatatattgtcgacatgaggtttt |
26478480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University