View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3107_high_36 (Length: 329)

Name: NF3107_high_36
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3107_high_36
NF3107_high_36
[»] chr1 (1 HSPs)
chr1 (30-312)||(24041862-24042156)


Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 312
Target Start/End: Complemental strand, 24042156 - 24041862
Alignment:
30 gcaacagcactagatgctgctgcttttaccggcttttcatgttcgagcggttttatttctgcggctgctattttcacctgttcaggaggtgtgctctgaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24042156 gcaacagcactagatgctgctgcttttaccggcttttcatgttcgagcggttttatttctgcggctgctattttcacctgttcaggaggtgtgctctgaa 24042057  T
130 c------------agaaactttcccacctgcactagactctggtttcgaggaatctgttacagcattttccgctgttgtcggagttttgtttatatcttc 217  Q
    |            ||||||||||||||| |||| |||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||    
24042056 ccgaaacatgttcagaaactttcccaccagcacaagactccggtttcgaggaacctgttacagcattttccggtgttgtcggagttttgtttttatcttc 24041957  T
218 ggcattaggaggaggaagccttgcctctggcggacgtgttttccatacggccgcggaaacggattgtaggaaaccaccattgttaccgaggtttg 312  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24041956 ggcattaggaggaggaagccttgcctctggcggacgtgttttccatacggccgcggaaacggattgtaggaaaccaccattgttaccgaggtttg 24041862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University