View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_53 (Length: 264)
Name: NF3107_high_53
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_53 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 49301805 - 49302051
Alignment:
| Q |
18 |
gaaccaacatgttaacaatgtaaagtatctaaggtggatgctagaggtaaattcaaaacaatattaatatactcattatcattcttcaatatttatacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301805 |
gaaccaacatgttaacaatgtaaagtatctaaggtggatgctagaggtaaattcaaaacaatattaatatactcattatcattcttcaatatttatacca |
49301904 |
T |
 |
| Q |
118 |
ttattagaatataatcaaatagttaactttcannnnnnnnattattgattattttacagaccattccagaccaaattctagagagtcaccaattatctgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301905 |
ttattagaatataatcaaatagttaactttcattttttttattattgattattttacagaccattccagaccaaattctagagagtcaccaattatctgg |
49302004 |
T |
 |
| Q |
218 |
tatcacactagaatatagaagggaatgtggaagttcagatatagttc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302005 |
tatcacactagaatatagaagggaatgtggaagttcagatatagttc |
49302051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University