View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3107_high_55 (Length: 260)

Name: NF3107_high_55
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3107_high_55
NF3107_high_55
[»] chr8 (2 HSPs)
chr8 (37-260)||(40804239-40804462)
chr8 (10-39)||(40804658-40804687)


Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 37 - 260
Target Start/End: Complemental strand, 40804462 - 40804239
Alignment:
37 agaaaggctttgtaactcttaacatatgtttggatgaacggtgagtttggtaaaatcatagtgacaatgtgctccaaagtgcaactttaattcaaacgtg 136  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||    
40804462 agaaaggctttgtaactcttaacgtatgtttggatgaacggtgagtttggtaaaatcacagtgacaatgtgctccaaagtgcaactttagtccaaacgtg 40804363  T
137 gtgactcgccgtgattctatcattcttaatgtgaatccagacatgcatgcatgttcaaattttatgtcgatggattttatgtcaatggaaaataaataaa 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40804362 gtgactcgccgtgattctatcattcttaatgtgaatccagacatgcatgcatgttcaaattttatgtcgatggattttatgtcaatggaaaataaataaa 40804263  T
237 acaagcagcaaagaaattaggcta 260  Q
    ||||||||||||||||||||||||    
40804262 acaagcagcaaagaaattaggcta 40804239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 39
Target Start/End: Complemental strand, 40804687 - 40804658
Alignment:
10 aagaagaataacatagagaggaaattgaga 39  Q
    ||||||||||||||||||||||||||||||    
40804687 aagaagaataacatagagaggaaattgaga 40804658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University