View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_73 (Length: 238)
Name: NF3107_high_73
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_73 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 8164952 - 8165155
Alignment:
| Q |
17 |
aattctcttcttggtagtttccttgtgaaatttctagtgtatgttgccctaacccttggaaatctttgagctttgaaggatatatattttttggtgtata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8164952 |
aattctcttcttggtagtttccttgtgaaatttctagtgtatgttgccctaacccttggaaatctttgagctttgaaggatatatattttttggtgtata |
8165051 |
T |
|
| Q |
117 |
tgagctatcctcagcatacacaactgcagagattaatctctcgagtctgataggagaactctgagcggtaggatctatatgcattagtcttttgacttct |
216 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8165052 |
tgagctatcctcaacatacacaactgtagagattaatctctcgagtctgataggataactttgagcggtaggatctatatgcattagtcttttgacttct |
8165151 |
T |
|
| Q |
217 |
aaac |
220 |
Q |
| |
|
|||| |
|
|
| T |
8165152 |
aaac |
8165155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University