View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_74 (Length: 238)
Name: NF3107_high_74
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 1217783 - 1217568
Alignment:
| Q |
18 |
cctcttagatatcaatgaataggactcaactacccttcaaatgtcacaactttccttgtcccatgacccactcttacacttagacaatcatgcagtcaaa |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1217783 |
cctcttagatatcaatgaataagactcaactacccttcaaatgtcacaactttccttgtcccatgacccactcttacacttagataatcatgcagtcaaa |
1217684 |
T |
|
| Q |
118 |
tagttgacacctcaaagtcgttggatcaagatcagacactttacattataagtttgataaatatatatgtccaataaggatcaaccgcttagattatcaa |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1217683 |
tagttgacacctcagagtcgttggatcaagatcagacactttacattataaatttgataaatatatatgtccaataaggatcaaccgtttagattatcaa |
1217584 |
T |
|
| Q |
218 |
ctgcataaatgcatga |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1217583 |
ctgcataaatgcatga |
1217568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University