View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_78 (Length: 234)
Name: NF3107_high_78
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 2 - 218
Target Start/End: Complemental strand, 47253657 - 47253442
Alignment:
| Q |
2 |
ctaatactagtggatggactaagacttaagattcagaagattttatccaacatgtatgagaatggaaagtcaaggttttaaactcctcaagctattattg |
101 |
Q |
| |
|
||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47253657 |
ctaatactagtggatggactaagacctta-attcagaagattttatccaacatgtatgagaatggaaagtcaaggttttaaactcctcaagctattattg |
47253559 |
T |
 |
| Q |
102 |
ttaacaactgagctacagctagttatttacggttaacctttttcaccgttgcagcaaattcttctccgagtctgcaaaataattaaccaagattttgaca |
201 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47253558 |
tcaacaactgagctacagctagttatttacggttaaactttttcaccgttgcagcaaattcttctccgagtctgcaaaataataaaccaagattttgaca |
47253459 |
T |
 |
| Q |
202 |
tgtatcactcatgtagg |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47253458 |
tgtatcactcatgtagg |
47253442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University