View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_83 (Length: 228)
Name: NF3107_high_83
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_83 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 52971594 - 52971816
Alignment:
| Q |
6 |
atatctcatggcatgtttggtaatcttgcacgagctgtcatcatcaattttctcaattttgctcaagcagtggttttaaccaagccatcatcagagaaat |
105 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52971594 |
atatctcatggcatgtttggtgatcttgcacgagctgtcatcatcaattttctcaattttgctcaagcagtggttttaaccaagccatcatcagagaaat |
52971693 |
T |
|
| Q |
106 |
tgttcaaattcctagatatgtatgagaccttgagggatgacgtggaacctgtcattacactcattaatgatgatggcttagagcaatgtgccaaggattt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
52971694 |
tgttcaaattcctagatatgtatgagaccttgagggatgacgtggaacctgtcattacactcattaatggtgatggtttagagcaatgtgccaaggattt |
52971793 |
T |
|
| Q |
206 |
ggcatacgagatgactatgacaa |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52971794 |
ggcatacgagatgactatgacaa |
52971816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University