View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_84 (Length: 227)
Name: NF3107_high_84
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_84 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 45179565 - 45179343
Alignment:
| Q |
7 |
gttcacagacgaggttggcaacatgcctttgaaacattttctctgatattgtgagtcaaatgcattgagtattgcaatttcactttatgtaattactgag |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45179565 |
gttcacagaagaggttggcaacatgcctttgaaacattttctctgatattgtgagtcaaatgcattgagtattgcaatttcactttatgtaattaccgag |
45179466 |
T |
|
| Q |
107 |
ttcatatttccaagaatgaaaataacgatattgaaatgctgactggatcaaatcttcagag--acctccagggtataatgtgacagatgctaaaacgtca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45179465 |
ttcatatttccaagaatgaaaataacgatattgaaatgctgactggatcaaatcttcagagacacctccagggtataatgtgacagatgctaaaacgtca |
45179366 |
T |
|
| Q |
205 |
ggcgtgcaaattaaatggactct |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45179365 |
ggcgtgcaaattaaatggactct |
45179343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 121 - 208
Target Start/End: Complemental strand, 45172630 - 45172543
Alignment:
| Q |
121 |
aatgaaaataacgatattgaaatgctgactggatcaaatcttcagagacctccagggtataatgtgacagatgctaaaacgtcaggcg |
208 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||| |||||||||| |||||||| | |||||||||||||||| ||| ||||||| |
|
|
| T |
45172630 |
aatgaaaacaacgatattgaaatgccaactggatcagatcttcagagccctccaggttctaatgtgacagatgctgaaaactcaggcg |
45172543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University