View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_86 (Length: 223)
Name: NF3107_high_86
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_86 |
 |  |
|
| [»] scaffold0205 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 20 - 136
Target Start/End: Original strand, 35990512 - 35990628
Alignment:
| Q |
20 |
tccaacacttactcgacactgacacatgtggtgacattcagttattttattttctcaagttattatcagtgttgacggggtagtgtggtgtctggtgtca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
35990512 |
tccaacacttactcgacactgacacatgtggttacattcagttattttattttctcaaattattatcagtgtcgacggggtagtgtggtgtctggtgtta |
35990611 |
T |
 |
| Q |
120 |
gtgtttcgtagaaatgg |
136 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35990612 |
gtgtttcgtagaaatgg |
35990628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 35990654 - 35990699
Alignment:
| Q |
163 |
gtttgctgtaatgagttgattttatggatgtgtaacttatcattga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35990654 |
gtttgctgtaatgagttgattttatggatgtgtaacttatcattga |
35990699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 95
Target Start/End: Original strand, 18268007 - 18268067
Alignment:
| Q |
35 |
acactgacacatgtggtgacattcagttattttattttctcaagttattatcagtgttgac |
95 |
Q |
| |
|
|||| |||||||||| | || |||| ||| || |||||||||| ||||||||||||||||| |
|
|
| T |
18268007 |
acaccgacacatgtgattacgttcaattaattcattttctcaaattattatcagtgttgac |
18268067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 91
Target Start/End: Complemental strand, 51733201 - 51733145
Alignment:
| Q |
35 |
acactgacacatgtggtgacattcagttattttattttctcaagttattatcagtgt |
91 |
Q |
| |
|
|||| ||||||| |||| || |||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
51733201 |
acaccgacacatctggtaacgttcaattattctattttctcaagttattatcggtgt |
51733145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 93
Target Start/End: Complemental strand, 31614195 - 31614135
Alignment:
| Q |
33 |
cgacactgacacatgtggtgacattcagttattttattttctcaagttattatcagtgttg |
93 |
Q |
| |
|
|||||||||||||| |||| ||| | |||||||| |||||||||| |||||||||||||| |
|
|
| T |
31614195 |
cgacactgacacatatggttacaattagttatttcattttctcaaactattatcagtgttg |
31614135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0205 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 77
Target Start/End: Complemental strand, 21473 - 21431
Alignment:
| Q |
35 |
acactgacacatgtggtgacattcagttattttattttctcaa |
77 |
Q |
| |
|
||||||| ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
21473 |
acactgatacatgtggttacattcaattattttattttctcaa |
21431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 2512799 - 2512757
Alignment:
| Q |
55 |
attcagttattttattttctcaagttattatcagtgttgacgg |
97 |
Q |
| |
|
||||| ||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
2512799 |
attcaattattttattttctcaaattattaccagtgttgacgg |
2512757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 91
Target Start/End: Original strand, 46179910 - 46179968
Alignment:
| Q |
33 |
cgacactgacacatgtggtgacattcagttattttattttctcaagttattatcagtgt |
91 |
Q |
| |
|
|||||| |||||||||| | | ||||| ||| ||||||||||||| ||||||||||||| |
|
|
| T |
46179910 |
cgacaccgacacatgtgattatattcaattaatttattttctcaacttattatcagtgt |
46179968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 89
Target Start/End: Original strand, 3262875 - 3262931
Alignment:
| Q |
33 |
cgacactgacacatgtggtgacattcagttattttattttctcaagttattatcagt |
89 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| | |||||||| ||||||||||| |
|
|
| T |
3262875 |
cgacactgacacatgtggttgcattcaaatatttcactttctcaaattattatcagt |
3262931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 91
Target Start/End: Complemental strand, 43328526 - 43328468
Alignment:
| Q |
33 |
cgacactgacacatgtggtgacattcagttattttattttctcaagttattatcagtgt |
91 |
Q |
| |
|
||||| ||||||||||||| ||||| | |||||| |||||||||| ||||||| ||||| |
|
|
| T |
43328526 |
cgacaatgacacatgtggttacattaaattatttcattttctcaaattattataagtgt |
43328468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 96
Target Start/End: Original strand, 26462652 - 26462708
Alignment:
| Q |
40 |
gacacatgtggtgacattcagttattttattttctcaagttattatcagtgttgacg |
96 |
Q |
| |
|
|||||||||| | ||||||| |||||| ||||||| || ||||||||||||| |||| |
|
|
| T |
26462652 |
gacacatgtgattacattcaattatttcattttcttaaattattatcagtgtcgacg |
26462708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 24875783 - 24875739
Alignment:
| Q |
33 |
cgacactgacacatgtggtgacattcagttattttattttctcaa |
77 |
Q |
| |
|
||||||||| ||||||||| ||||||| ||||| ||||||||||| |
|
|
| T |
24875783 |
cgacactgatacatgtggttacattcaattattctattttctcaa |
24875739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University