View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_high_92 (Length: 204)
Name: NF3107_high_92
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_high_92 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 40265745 - 40265571
Alignment:
| Q |
17 |
tgaaataatggattataatatgtacatatatatgttaaacaaaattaaaatttaatggggggctgttaagagttcagaacatttggtcacgcttcagatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40265745 |
tgaaataatggattataatatgtacatatatatgttaaacaaaattaaaatttaatggggggctgttaagagttcagaatatttggtcacgcttcagatg |
40265646 |
T |
|
| Q |
117 |
ttcagttctcgatatgaggggggtgttaagagttcgacattagataagataaaccgtaaatatgagtttataggt |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40265645 |
ttcagttctcgatatgagggggatgttaagagttccacgttagataagataaaccgtaaatatgagtttataggt |
40265571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University