View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_23 (Length: 403)
Name: NF3107_low_23
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 67 - 397
Target Start/End: Original strand, 4746517 - 4746847
Alignment:
| Q |
67 |
attcccaatggtttatcctagtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggtt |
166 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4746517 |
attcccaatggttgatcctagtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggtt |
4746616 |
T |
 |
| Q |
167 |
gggaaaatcacaaaatctcccaccaggtgatatgggttggcctttctttggtaacatgcctaccttcgccaaatatgctaaatctgatcctgactcactc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4746617 |
gggaaaatcacaaaatctcccaccaggtgatatgggttggcctttctttggtaacatgcctaccttcgccaaatatgctaaatctgatcctgactcactc |
4746716 |
T |
 |
| Q |
267 |
atctataaccttatctccaggtattcatccatctatgcttcggttcatctacaaaaccttgaaatataaataaataaaatcttatatttcaatatatgta |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4746717 |
atctataaccttatctccaggtattcatccatctatgcttcggttcatctacaaaaccatgaaatataaataaataaaatcttatatttcaatatatgta |
4746816 |
T |
 |
| Q |
367 |
atatttgattttctttgtctctttcttttca |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4746817 |
atatttgattttctttgtctctttcttttca |
4746847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 67 - 233
Target Start/End: Original strand, 4756123 - 4756289
Alignment:
| Q |
67 |
attcccaatggtttatcctagtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggtt |
166 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4756123 |
attcccaatggttgatcctagtagcagctttgttgggtggatatgcatttgtgtttggtttcctaaggagattgaatgaatggtactatgttggtaggtt |
4756222 |
T |
 |
| Q |
167 |
gggaaaatcacaaaatctcccaccaggtgatatgggttggcctttctttggtaacatgcctaccttc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4756223 |
gggaaaatcacaaaatctcccaccaggtgatatgggttggcctttctttggtaacatgcctaccttc |
4756289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University