View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_57 (Length: 273)
Name: NF3107_low_57
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 135 - 257
Target Start/End: Original strand, 34437156 - 34437278
Alignment:
| Q |
135 |
aaatgtaagttgtacttatagacgataaaatgtaagacaaattataaataaacacacgatgtcgcatatgatgtctatactttgatgtttaaataaaagt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34437156 |
aaatgtaagttgtacttatagacgataaaatgtaagacaaattataaataaacacacgatgtcgcatatgatgtctatactttgatgttcaaataaaagt |
34437255 |
T |
 |
| Q |
235 |
tgtattgattattatcatattct |
257 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34437256 |
tgtattgattattatcatattct |
34437278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 82 - 119
Target Start/End: Original strand, 34437100 - 34437137
Alignment:
| Q |
82 |
taattaaaaaaatgatttttgaacattaaaataccgtg |
119 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
34437100 |
taattagagaaatgatttttgaacattaaaataccgtg |
34437137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University