View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_65 (Length: 253)
Name: NF3107_low_65
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_65 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 31 - 253
Target Start/End: Original strand, 39275153 - 39275380
Alignment:
| Q |
31 |
taatcatatcatatatataaaggttcatatattccatagcttcagaatgagttacagataacattgatcatatatatgaagcaccatttataatcagggc |
130 |
Q |
| |
|
|||||||| |||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39275153 |
taatcataacatatatataaaagtccatatatttcatagcttcagaatgagttacagataacattgatcatatataggaagcaccatttataatcagggc |
39275252 |
T |
 |
| Q |
131 |
aacttattaaaatatgaaaacagcaaacaaagcacacaatttattgatact-----cgatccagaggtagtaacggtaaccaagcaagcatgcgcatatt |
225 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
39275253 |
aaattattaaaatatgaaaacagcaaacaaagcacacaatttattgatactcgatccgatccagaggtagtaacagtaaccaagcaagcatgcgcatgtt |
39275352 |
T |
 |
| Q |
226 |
agacccccttgagtgtccaattgacttt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39275353 |
agacccccttgagtgtccaattgacttt |
39275380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University