View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_66 (Length: 253)
Name: NF3107_low_66
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_66 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 147 - 253
Target Start/End: Original strand, 33479480 - 33479586
Alignment:
| Q |
147 |
aacttgtaagatgttaatgtttgacacaactcagcacacataataataatggtgacagtaagcatgccttcaaatttattccatttttgaatattttatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33479480 |
aacttgtaagatgttaatgtttgacacaactcagcacacataataataatggtgacagtaagcatgccttcaaatttattccatttttgaatattttatt |
33479579 |
T |
 |
| Q |
247 |
tataatt |
253 |
Q |
| |
|
||||||| |
|
|
| T |
33479580 |
tataatt |
33479586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University