View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3107_low_69 (Length: 250)

Name: NF3107_low_69
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3107_low_69
NF3107_low_69
[»] chr6 (1 HSPs)
chr6 (1-240)||(1216703-1216942)


Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 1216942 - 1216703
Alignment:
1 catcatagataacatgttgcagccagttggagggtccaggcccactttgacttcaagtactgcaaactgaagaacgtctcaaaagattcaggaaaactta 100  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
1216942 catcatagataacatgctgcagccagttggagcgtccaggcccactttgacttcaagtactgcaaagtgaagaacgtctcaaaagattcaggaaaactta 1216843  T
101 tatacgaagttgggtaacctaatcttacagtggcgtggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1216842 tatacgaagttgggtaacctaatcttacagtggcgtggcgtaaacaaacataatagataacaattctaatgtaccttgcactttaatggtgtcaataaat 1216743  T
201 tttttgggtttaggaacaacacccccactttgaatctctg 240  Q
    ||||||||||||||||||||||||||||||||||||||||    
1216742 tttttgggtttaggaacaacacccccactttgaatctctg 1216703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University