View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_75 (Length: 244)
Name: NF3107_low_75
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 40804009 - 40803781
Alignment:
| Q |
1 |
atcaatatgctgaagtgagagttgacacaatgtcttgactcaaaatctttacatattggatatatggatctttatttagctcaagtgttatcaaattcag |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
40804009 |
atcaatatgctgaagtgagagttgagacaatgtcttgactcaaaatctttacatattggatatatggacctttatttagctcaagtcttatcaaattcag |
40803910 |
T |
 |
| Q |
101 |
gactaattattcgcatttgaattaaaacaatctttccacaagtgaaaactacttttgctactatgattcaatgatgtatatagatccatttccactctcc |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40803909 |
gactaattattcacatttgaattaaaacaatctttccacaagtgaaaactacttttgctactacgattcaatgatgtatatagatccatttccactctcc |
40803810 |
T |
 |
| Q |
201 |
ctttcagtggaattttgggtcaagttgtt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40803809 |
ctttcagtggaattttgggtcaagttgtt |
40803781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University