View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_78 (Length: 239)
Name: NF3107_low_78
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_78 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 5465137 - 5465031
Alignment:
| Q |
1 |
aaaactagtcgcgatatttagcattgctctttattaaaatttgacacatgtttcgtgatgtttgtgattcctttatttcactacatatatcattggtcct |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5465137 |
aaaactagtcgcgatatttagcattcctctttattaaattttgacacatgtttcgtgatgtttgtgattcctttatttcactccatatatcattggtcct |
5465038 |
T |
|
| Q |
101 |
taacgtc |
107 |
Q |
| |
|
||||||| |
|
|
| T |
5465037 |
taacgtc |
5465031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 165 - 224
Target Start/End: Complemental strand, 5464995 - 5464936
Alignment:
| Q |
165 |
atggtttgtgcttgtaggtaatttgaccatatgaatttggaaatttcatgacaataattt |
224 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5464995 |
atggtttgtgcttgtacgtaatttgaccatatgaatttggaaatttcatgacaataattt |
5464936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University