View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_86 (Length: 233)
Name: NF3107_low_86
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 36745877 - 36746086
Alignment:
| Q |
1 |
aacgagttggtggaatcctgctcaataatcatatggcttgcatccgctttccacgcagctgtcaatttcggacaatatccttacggtggtttaatcttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36745877 |
aacgagttggtggaatcctgctcaataatcatatggcttgcatccgctttccacgcagctgtcaatttcggacaatatccttacggtggtttaatcttga |
36745976 |
T |
 |
| Q |
101 |
accgaccaactatgacaaggaggttaattcctgaaaagggaaccaaagaatatgaagagatggagaaagatgaccaaagggcttatttgagaacaatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36745977 |
accgaccaactatgacaaggaggttaattcctgaaaagggaaccaaagaatatgaagagatggagaaagatgaccaaagggcttatttgagaacaatcac |
36746076 |
T |
 |
| Q |
201 |
accaaagacc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
36746077 |
accaaagacc |
36746086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 113
Target Start/End: Original strand, 42689650 - 42689713
Alignment:
| Q |
50 |
tccacgcagctgtcaatttcggacaatatccttacggtggtttaatcttgaaccgaccaactat |
113 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| ||||| || | ||||| |||||||| |
|
|
| T |
42689650 |
tccacgcagctgttaattttggacaatatccttacggcggttttattctaaaccgcccaactat |
42689713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University