View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3107_low_89 (Length: 228)
Name: NF3107_low_89
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3107_low_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 19 - 129
Target Start/End: Original strand, 4948969 - 4949081
Alignment:
| Q |
19 |
ctgtgtgacagcaaaggatctcctgggaagcatacgacaggctttaatcattcaaaattaaccatttgaagga--atttaatctactacatcaataagtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4948969 |
ctgtgtgacagcaaaggatctcctgggaagcatacgacaggctttaatcatccaaaattaaccatttgaaggaatatttaatctactacatcaataagtt |
4949068 |
T |
|
| Q |
117 |
tactcaacaacga |
129 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4949069 |
tactcaacaacga |
4949081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University