View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3107_low_94 (Length: 220)

Name: NF3107_low_94
Description: NF3107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3107_low_94
NF3107_low_94
[»] chr4 (1 HSPs)
chr4 (9-204)||(52987983-52988178)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 9 - 204
Target Start/End: Complemental strand, 52988178 - 52987983
Alignment:
9 cgagagagatgaaatatctattgacatcataaccgagcacgttgaattagcctcgatgcatggttgttcaagtctggcagagaaagaaaaagattcttgt 108  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
52988178 cgagacagatgaaatatctattgacatcataaccgagcacgttgaattagcctcgatgcatggttgttcaaatctggcagagaaagaaaaagattcttgt 52988079  T
109 acagactgccccaaattgcctgttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgttgcaagaatgagggctattcaaag 204  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52988078 aaagactgccccaaattgcctgttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgttgcaagaatgagggctattcaaag 52987983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University