View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3108_low_8 (Length: 315)
Name: NF3108_low_8
Description: NF3108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3108_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 27939298 - 27939584
Alignment:
| Q |
19 |
aaaccattctccatctcatcatcaagaacatcacgattacgctccaccattgttctccttcccctatgtgtgatgttcaactgtgaagaggaaccctcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27939298 |
aaaccattctccatctcatcatcaagaacatcgcgattacgctccaccattgttctccttcccctatgtgtgatgttcaactgtgaagaggaaccctcac |
27939397 |
T |
|
| Q |
119 |
taatgatcccatcaaatgttaagtaaagcatatcgcacgatttagaattgatcgatcgttggtggaccctactatgtgaattataagtaggggacaaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27939398 |
taatgatcccatcaaatgttaagtaaagcatatcacacgatttagaattgatcgatcgttggtggaccctactatgtgaattataagtaggggacaaaat |
27939497 |
T |
|
| Q |
219 |
tatttggtgatctaacctatgttctccaatgacaccctcgctccttgcatttctagaattattactatcgaaagatctccttgatga |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27939498 |
tatttggtgatctaacctatgttctccaatgacaccctcactccttgcatttctagaattattactatcgaaagatctcctagatga |
27939584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University