View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3108_low_9 (Length: 237)
Name: NF3108_low_9
Description: NF3108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3108_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 44695489 - 44695258
Alignment:
| Q |
1 |
cacagaggacactttttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaa--attaattaatgttttgtac |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44695489 |
cacaaaggacactttttctttgttttgatttcaccttttaaatacattgatctcaaatctttttggagtctttgaggaattattaattaatgttttgtac |
44695390 |
T |
 |
| Q |
99 |
ggcaggaatggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatcatatca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695389 |
ggcaggaatggtgaaactttgcctcaaatatcaaaggaatacataagagtaaagtaagtggtgcaagttagcatgcatggctgatcgatccatcatatca |
44695290 |
T |
 |
| Q |
199 |
acattacatttttccattttgccatgatgatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44695289 |
acattacatttttccattttgccatgatgatg |
44695258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University