View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3110_high_9 (Length: 216)
Name: NF3110_high_9
Description: NF3110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3110_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 48 - 198
Target Start/End: Complemental strand, 2699216 - 2699066
Alignment:
| Q |
48 |
tatctttactatgtgtcacgtgttttagtgggcccatgcttactgtatcatttttatttttatatctaaaaggaaaggacaagccatgtttatggtgnnn |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2699216 |
tatctttactatgtgtcacgtgttttagtgggcccatgcttactgtatcatttttatttttatatgtaaaaggaaaggacaagccatgtttatggtgttt |
2699117 |
T |
 |
| Q |
148 |
nnnnnaatacacgtttcctacatttccttgaaggttgcaatctcaccctta |
198 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2699116 |
tttttaatacacgtttcctacttttccttgaaggttgcaatctcaccctta |
2699066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University