View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3110_low_5 (Length: 356)
Name: NF3110_low_5
Description: NF3110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3110_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 67 - 244
Target Start/End: Complemental strand, 43285859 - 43285680
Alignment:
| Q |
67 |
gcatctagtgtagaaccaatggaaataagctttaataatcatttcagattaggtctaataaaatagactagactatacaatttagtaaacaaaagtttgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43285859 |
gcatctagtgtagaaccaatggaaataagctttaataatcattttagattaggtctaataaaatagactagactatacaatttagtaaacaaaagtttgt |
43285760 |
T |
 |
| Q |
167 |
atcttaactacaagatataccaatatttaatgtcatcatgccctaaccaaaattatttttagt--agaaaatttatgaag |
244 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43285759 |
atcttaattacaagatataccaatatttaatgtcatcatgccctaaccaaaattatttttagtagagaaaatttatgaag |
43285680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 16 - 44
Target Start/End: Complemental strand, 43285884 - 43285856
Alignment:
| Q |
16 |
atgttatatatccaaagaagaaagagcat |
44 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43285884 |
atgttatatatccaaagaagaaagagcat |
43285856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University