View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3110_low_8 (Length: 258)
Name: NF3110_low_8
Description: NF3110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3110_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 12 - 117
Target Start/End: Complemental strand, 10495541 - 10495436
Alignment:
| Q |
12 |
tagagatattaaaatgaaattttgggatttccaatagcagtaacgattcaatcgagttaaaattgaaaatacattattcttaaggttagtattttatgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10495541 |
tagagatattaaaatgaaattttgggatttccaatagcagtaacgattcaatcgagttaaaattgaaaatacattattcttaaggttagtattttatgtt |
10495442 |
T |
|
| Q |
112 |
acatag |
117 |
Q |
| |
|
|||||| |
|
|
| T |
10495441 |
acatag |
10495436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 152 - 240
Target Start/End: Original strand, 54012201 - 54012289
Alignment:
| Q |
152 |
taaaagaagaaattcaataacatgacaaaccttgttcaatgcagctaggctaatgactttaacacccattttatcagccctgaggattg |
240 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012201 |
taaaagaagaaattcaataatatgacaaaccttgttcaatgcagctaggctaatgactttaacacccattttatcagccctgaggattg |
54012289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 12 - 112
Target Start/End: Original strand, 29822229 - 29822328
Alignment:
| Q |
12 |
tagagatattaaaatgaaattttgggatttccaatagcagtaacgattcaatcgagttaaaattgaaaatacattattcttaaggttagtattttatgtt |
111 |
Q |
| |
|
||||| |||||| |||||||||| | ||||| ||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
29822229 |
tagagttattaatatgaaattttag-atttcaaatagcagtaacgatccaattgagttaaaattgaaaatacaacattcttaaggttagtattatatgtt |
29822327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University