View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3111_low_4 (Length: 239)
Name: NF3111_low_4
Description: NF3111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3111_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 25742870 - 25743066
Alignment:
| Q |
21 |
catgtaaatcagataattctcctagttcatcaatggaagatccatattcttttcctatgaaaaagtcacttagtttttgtaggtttgtcaatgcacataa |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742870 |
catgtaaatcagataattctcctatttcatcaatggaagatccatattcttttcctatgaaaaagtcacttagtttttgtaggtttgtcaatgcacataa |
25742969 |
T |
 |
| Q |
121 |
atgcaatggcatccatttcaaactcgtacaagtaatatctaagtaacgcaggttaactaacctatgaaaatctttaggaagttcttgtaggttagtacat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25742970 |
atgcaatggcatccatttcaaactcgtacaagtaatatctaagtaacgcaggttaactaacctatgaaaatctttagga-----ttgtaggttagtacat |
25743064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University