View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3111_low_5 (Length: 227)
Name: NF3111_low_5
Description: NF3111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3111_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 46 - 196
Target Start/End: Complemental strand, 21369309 - 21369165
Alignment:
| Q |
46 |
gacaacaatttggatgattaacacagcctaaatatatgattcgttatgttatgtttagtagatggttaatactatattttaaagttaataggtataacaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
21369309 |
gacaacaatttggatgattaacacagcctaaatatatgattcgttatgtt-----tagtagatggttaatactttattttaaacttattaggtataacaa |
21369215 |
T |
|
| Q |
146 |
actttcgcaatccattagttcgtctattgaacacacttaaccactatttta |
196 |
Q |
| |
|
| |||||||| ||||||||| || ||||||||||||||||||| |||||| |
|
|
| T |
21369214 |
agtttcgcaagccattagtt-atccattgaacacacttaaccacgatttta |
21369165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University