View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3111_low_6 (Length: 209)
Name: NF3111_low_6
Description: NF3111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3111_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 132 - 193
Target Start/End: Complemental strand, 1718489 - 1718428
Alignment:
| Q |
132 |
gtttagttggctatagtggttaatcatcagttaattaatttgagttgccacttagtgttcat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718489 |
gtttagttggctatagtggttaatcatcagttaattaatttgagttgccacttagtgttcat |
1718428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University