View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3111_low_7 (Length: 204)
Name: NF3111_low_7
Description: NF3111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3111_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 17 - 150
Target Start/End: Complemental strand, 21820566 - 21820433
Alignment:
| Q |
17 |
aaaagtaagatgaaattaatccactcgtggaatataatataagtactagaatgctaaaatacaagagactatcaaaggaagagaggagaaatgtcatcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21820566 |
aaaagtaagatgaaattaatccactcgtggaatataatataaatactagaatactaaaatacaagagactatcaaaggaagagaggagaaatgtcatcaa |
21820467 |
T |
|
| Q |
117 |
nnnnnnnctcccccttgcttatcaatcattgcta |
150 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
21820466 |
tttttttctcccctttgcttatcaatcattgcta |
21820433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University