View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112-Insertion-22 (Length: 159)
Name: NF3112-Insertion-22
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112-Insertion-22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 6 - 159
Target Start/End: Complemental strand, 31980890 - 31980737
Alignment:
| Q |
6 |
caagatgttccaatttgatttcacatccatcaactccggtcgcgcctccaccatctcttgcatcgatcttctaaaatccatataaggatcgggcgagtag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31980890 |
caagatgttccaatttgatttcacatccatcaactccggtcgcgcctccaccatctcttgcatcgatcttctaaaatccatataaggatcgggcgagtag |
31980791 |
T |
 |
| Q |
106 |
gttggtactgccacacttccgttgaacaaaacctcctctttctctttctcttgt |
159 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31980790 |
gttggtactgccacacttccattgaacaaaacctcctctttctctttctcttgt |
31980737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 9e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 9e-16
Query Start/End: Original strand, 33 - 131
Target Start/End: Original strand, 38042383 - 38042481
Alignment:
| Q |
33 |
catcaactccggtcgcgcctccaccatctcttgcatcgatcttctaaaatccatataaggatcgggcgagtaggttggtactgccacacttccgttgaa |
131 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||||| || |||| ||||||||| ||||| || || || || ||||| || ||||||||||||||||| |
|
|
| T |
38042383 |
catcaactctggttgcgcttccaccatctcttgcattgaccttcgaaaatccatgtaagggtccggtgaatatgttggcaccgccacacttccgttgaa |
38042481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University