View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112-Insertion-25 (Length: 92)
Name: NF3112-Insertion-25
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112-Insertion-25 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 42089008 - 42089090
Alignment:
| Q |
10 |
tgcttggtaacacgatgctatactaaattaatatattttttgttctgttaactttctctttttgatctccatcattgtctgca |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42089008 |
tgcttggtaacacgatgctatactaaattaatatattttttgttctgttaactttctctttttgatctccattattgtctgca |
42089090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University