View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112R-Insertion-12 (Length: 203)
Name: NF3112R-Insertion-12
Description: NF3112R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112R-Insertion-12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 97 - 168
Target Start/End: Complemental strand, 49310521 - 49310450
Alignment:
| Q |
97 |
ctccgattcatctctctcatctaacggttacgatctcctcgtttctccaatcgtacggccaggggtcctttt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49310521 |
ctccgattcatctctctcatctaacggttacgatctcctcgtttctccaatcgtacggccaggggtcctttt |
49310450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University