View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112R-Insertion-13 (Length: 201)
Name: NF3112R-Insertion-13
Description: NF3112R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112R-Insertion-13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 9 - 199
Target Start/End: Complemental strand, 39784513 - 39784315
Alignment:
| Q |
9 |
gtttgagcaactgatcacttatgaacttttttatatacattttttatagcataaaagtttatttgagacggactctggaaatttactagaatggggatag |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
39784513 |
gtttgagcaaccgatcacttatgaacttttttatatacattttttatagcataaaagtttatttgagacggactctagaaatttactggaatgggaatag |
39784414 |
T |
 |
| Q |
109 |
acttc--------aagagtgtttataaatctacttacaaatcacatcaaatttttatctacatttactctacgtgttccattatattcttattctctct |
199 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784413 |
acttcaaaattcaaagagtgtttataaatctatttacaaatcacatcaaatttttatctacatttactctacgtgttccattatattcttattctctct |
39784315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University