View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112R-Insertion-15 (Length: 62)
Name: NF3112R-Insertion-15
Description: NF3112R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112R-Insertion-15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 27897993 - 27897940
Alignment:
| Q |
9 |
ctttggtttcccatctgacatggacgtcgaagcgcttatgcagatacaccctct |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27897993 |
ctttggtttcccatctgacatggacgtcgaagcgcttgtgcagatacaccctct |
27897940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University