View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112R-Insertion-16 (Length: 59)
Name: NF3112R-Insertion-16
Description: NF3112R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112R-Insertion-16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.00000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.00000000006
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 45654385 - 45654418
Alignment:
| Q |
8 |
atcaagatcaacaacatcgacatcgtcatcggcg |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45654385 |
atcaagatcaacaacatcgacatcgtcatcggcg |
45654418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University