View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112R-Insertion-7 (Length: 387)
Name: NF3112R-Insertion-7
Description: NF3112R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112R-Insertion-7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 9 - 387
Target Start/End: Complemental strand, 5172122 - 5171749
Alignment:
| Q |
9 |
attattgcgctatgagaggtggaagatccaagatgatataaggcctcatattttctgtattaagcttaaagctcatatttctcaccatagaaatctcgta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5172122 |
attattgcgctatgagaggtggaagatccaagatgatataaggcctcatattttctgtattaagcttaaagctcatatttctcaccatagaaatctcgta |
5172023 |
T |
 |
| Q |
109 |
ggaccccttcatcattcctaacacaactgaattttacagattgaaacgtggctgttgtacccaacactaacagtttgttgttgtgtctatataaactgtg |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5172022 |
ggaccccttcatcattcctaacacagctgaattttacagattgaaacgtggctgttgtacccaacactaacagtttgttgttgtgtctatataacctgtg |
5171923 |
T |
 |
| Q |
209 |
cttttatgttgggccctttgttacctctagcggaggcagttatgtactcagttggaaagataattgctctttaggcacttgctatttcaaccgcagttaa |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5171922 |
cttttatgttgggccctttgttacctctagcggaggcagttatgtgctcagttgg-aagataattgctctttaggcacttgctatttcaacggcagttaa |
5171824 |
T |
 |
| Q |
309 |
ctatcattcgttcgtttattcacagtagttaattgatgttcattcaatatcagcggcagttaactaccgttgtgttttg |
387 |
Q |
| |
|
|||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5171823 |
ctatca----ttcgtttatttacagtatttaattgatgttcattcaatatcagcggcagttaactaccgctgtgttttg |
5171749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University