View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_high_12 (Length: 321)
Name: NF3112_high_12
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 305
Target Start/End: Original strand, 37195048 - 37195348
Alignment:
| Q |
20 |
ttactctccccctccatttcttcaccattcccattaccatc------------atcatcttttaaaccacccatcttttgctccaatccttcaaatctct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195048 |
ttactctccccctccatttcttcaccattcccattaccatcatcatcatcatcatcatcttttaaaccacccatcttttgctccaatccttcaaatctct |
37195147 |
T |
 |
| Q |
108 |
ctcgaagactcttccttccttctgtttcgggtatctgggacgccatcaccggcggcagcggcaataacaacaccaatgaagcccttctcgcaattcgacg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37195148 |
ctcgaagactcttccttccttctgtttccggtatctgggacgccatcaccggcggcagcggcaataacaacaccaatgaagcccttctcgcaattcgacg |
37195247 |
T |
 |
| Q |
208 |
cggaatgtctctcttcagacaggtacacaacgtttcttttcaatatctttaatggtgagttgtaac---taactagtactcattgtttagggtgaagttt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37195248 |
cggaatgtctctcttcagacaggtacacaacgtttcttttcaatatctttaatggtgagttgtaactagtaactagtactcattgtttagggtgaagttt |
37195347 |
T |
 |
| Q |
305 |
t |
305 |
Q |
| |
|
| |
|
|
| T |
37195348 |
t |
37195348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University