View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_high_15 (Length: 256)
Name: NF3112_high_15
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 99 - 218
Target Start/End: Complemental strand, 49310071 - 49309955
Alignment:
| Q |
99 |
attattgttactgatgccagatttagatccatcatggtgttataatagtcttcgaatcttcaaatcatgtttatttgtagtagtaaaatattattattat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49310071 |
attattgttactgatgccagatttagatccatcatggtgttataatagtcttcgaatcttcaaatcatgtttatttgtagtagtaaaatattattat--- |
49309975 |
T |
|
| Q |
199 |
tattttttctttaacagttt |
218 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
49309974 |
tattttttctttaactgttt |
49309955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University