View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_high_22 (Length: 227)
Name: NF3112_high_22
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 34570475 - 34570275
Alignment:
| Q |
12 |
agcacagacaatataaatgcttcaaagcggggaattcttagaacgtcattatgaactttataaactaaatgaccatgctttctaatgcagggtcggctat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570475 |
agcacagacaatataaatgcttcaaagcggggaattcttagaatgtcattatgaactttataaactaaatgaccatgctttctaatgcagggtcggctat |
34570376 |
T |
 |
| Q |
112 |
ttctttctgcaagggttctgggattttatgcaaatttgtttgggcataaaacaaaatttttcttcctttgggaagatattgataacattcaagtgcttcc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570375 |
ttctttctgcaagggttctgggattttatgcaaatttgtttggacataaaacaaaatttttcttcctttgggaagatattgataacattcaagtgcttcc |
34570276 |
T |
 |
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
34570275 |
t |
34570275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 193
Target Start/End: Original strand, 56175998 - 56176094
Alignment:
| Q |
97 |
tgcagggtcggctatttctttctgcaagggttctgggattttatgcaaatttgtttgggcataaaacaaaatttttcttcctttgggaagatattga |
193 |
Q |
| |
|
|||||||||| |||||| |||| ||||| | || |||||| |||||||||||||||| || || |||||||| || || |||||||| || ||||| |
|
|
| T |
56175998 |
tgcagggtcgtctatttgtttcagcaagaatacttggatttcatgcaaatttgtttggacacaagacaaaattctttttgctttgggaggacattga |
56176094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University