View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_low_13 (Length: 321)
Name: NF3112_low_13
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 32616133 - 32616445
Alignment:
| Q |
1 |
tgaagggacaacttatttctggagtcttaagtcatgctcagaatgatatggttggtaggatgctccatgatgatggtacagctgataaagatgctatcaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616133 |
tgaagggacaacttatttccggagtcttaagtcatgctcagaatgatatggttggtaggatgctccatgatgatggtacagctgataaagatgctatcaa |
32616232 |
T |
|
| Q |
101 |
aaggtctgcatattta--------attacacgtatgacagtatatataaatatgttttttatgagtgttttcttgctccttgtgatgcaataggttattt |
192 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616233 |
aaggtctgcatatttatatctttgattacacgtatgacaatatatataaatatgttttttatgagtgttttcttgctccttgtgatgcaataggttattt |
32616332 |
T |
|
| Q |
193 |
gagcaagttgatggcgatggcaataaccatgtttcaagatccgagttagagaaagtagttagggagactcattttggtaaggctgtagatgcagaggaag |
292 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616333 |
gagcaagttgatggcgatggcgataaccatgtttcaagatccgagttagagaaagtagttagggagactcattttggtaaggctgtagatgcagaggaag |
32616432 |
T |
|
| Q |
293 |
cagtctcaaaact |
305 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32616433 |
cagtctcaaaact |
32616445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 32634511 - 32634615
Alignment:
| Q |
12 |
cttatttctggagtcttaagtcatgctcagaatgatatggttggtaggatgctccatgatgatggtacagctgataaagatgctatcaaaaggtctgcat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||| ||||| | ||||| |||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
32634511 |
cttatttctggagtcttaagtcatgctcagagtgatagggttggtaggctgctcaaagatgacggtacacctgataaagatgctatcaaaaggtctacat |
32634610 |
T |
|
| Q |
112 |
attta |
116 |
Q |
| |
|
|||| |
|
|
| T |
32634611 |
gttta |
32634615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University